中文
Home >Products> Synthesizers | Sequencers | Cell Analysis >DNA / Organic / Polypeptide Synthesizers> Nucleic acid synthesizer（AUTOOLIGO25~150）
Synthesizers | Sequencers | Cell Analysis:
DNA / Organic / Polypeptide Synthesizers
Genomics / Sequencers
Cell Analysis
Proteomics
- Nucleic acid synthesizer（AUTOOLIGO25~150）
- Product Detail
- Company Profile
- UTOOLIGO is a flexible and intuitive full-automatic oligonucleotide synthesizer, which can be used for 1 μ The rapid synthesis of mol-50mmol nucleic acid sample is suitable for clinical research, medical development and the synthesis of molecular diagnostic probes.
AUTOOLIGO comes in four models:
● AUTOOLIGO, synthesis capacity 10~100 μ mol
● AUTOOLIGO100, synthetic capacity 50 μ mol~9mmol
● AUTOOLIGO150, synthesis capacity 150 μ mol~12 mmol
● AUTOOLIGO600, synthesis capacity 1mmol-50mmol
Unique AutoOligo adopts a high-precision metering pump drive system, which is compatible with reagents for nucleic acid synthesis. The adoption of flow solid phase column synthesis technology can significantly reduce reagent consumption, ensure the accurate control of reaction speed and contact time, and at the same time, the synthesis efficiency is higher, facilitating linear amplification, so as to obtain cost-effective and high-quality synthesis results.
AUTOOLIGO can use up to 14 kinds of monomers at the same time, and continuously and automatically perform the synthesis process on 1 or 3 or 8 columns.
The CD System workstation has a powerful data management system to provide you with a complete and reliable nucleic acid synthesis method development platform.
● High precision metering pump, flow path resistant to organic reagents;
● Multiple column positions are optional;
● High degree of automation and low reagent consumption;
● Monomer solution recycling;
● Sequential synthesis;
● High production capacity: one synthetic cycle can be completed within 20 minutes at the earliest;
● Online monitoring of ultraviolet, conductivity signal and pressure;
● The software interface is friendly and the method can be edited flexibly;
● Comply with relevant regulations and requirements of FDA and USP;
Equipment parameters (AUTOOLIGO25~150)
| No. | project | Parameter Description |
| 1 | Current Speed | Oligo 25: 2 x 25ml/min |
| 2 | Synthesis scale | Oligo 100: 2 x 100ml/min |
| 3 | Synthetic efficiency | Oligo 150: 2 x 150ml/min |
| 4 | Cycle time | one μ mol ~ 12mmol |
| 5 | System pump | ＞99%forDNA ＞98%forRNA |
| 6 | Number of composite columns | 4.5 to 25 min (standard DNA) |
| 7 | Number of monomer entrances | Two pump system |
| 8 | UV detector | 1. 3. Maximum 8 |
| 9 | Conductivity detector | 8. 14 |
| 10 | System protection | UV detector Wavelength range of UV detector: 200-600nm, 4 channels |
| 11 | Intake pressure | Argon or nitrogen |
| 12 | valve | 0.3~0.35bar |
| 13 | Control system | 7 low dead volume valves |
| 14 | Chemical solvent compatibility | CDSystem |
| Dimensions (WxHxD) | Compatible with common reagents for DNA and RNA synthesis, acetonitrile, coupling reagents, capping agents, oxidizing agents, capping agents, thio reagents, etc. (incompatible with tetrahydrofuran) | |
| 15 | weight | 400 x 550 x 480mm |
| 16 | Power Supply | 60kg |
| 17 | project | 220V |
Synthesis case 1: DNA 17mer synthesis
objective
Synthesis of an oligonucleotide DNA strand, sequence: CTACGCCACGAGCTACTACCA, synthesis amount 0.24 mmol
● Environmental conditions
Room temperature 25 ℃ Humidity 60%
● Laboratory supplies
1. Nucleic acid synthesizer: AUTOOLIGO 100
2.6.3ml synthetic column
3. Carrier: HYS 350
4. Deprotection reagent: coupling reagent, oxidation reagent, blocking reagent, anhydrous acetonitrile, ammonia
5. Monomer: A, C, G, T
6.0.3bar ammonia
7. Mass spectrometer: Waters - THERMO
8 . HPLC: WATERS
Case 3: RNA 21mer synthesis:Purpose:
Synthesis of one RNA chain, 21mer, synthesis amount 245 μ mol
Instrument: AUTOOLIGO results and analysis:
The purity of the crude product was 84.84% and 94.37% after one-step purification. The molecular weight detected by mass spectrometry is 7097.7, which is consistent with the theoretical value (7096.8).
-
Suzhou COSTONES Instruments Co., Ltd. (COSTONES) is an instrument company focusing
on separation and purification. It is an equipment supplier and service provider
for biopharmaceutical, cell therapy and gene testing. It is committed to providing
users with industry-leading technical support and services.
The company has a perfect service system and executive power. It interprets the
user experience from the four aspects of technical communication, scheme design,
technical support and after-sales service, and tries to achieve seamless connection
in every link until it is recognized by customers.
For a long time, we have maintained good cooperative relations with domestic and
foreign suppliers. The main products include protein purification system,
compressible chromatographic column, ultrafiltration system, chromatographic
ultrafiltration accessories, etc., and provide maintenance services and customized
product services;
At present, Suzhou quarrying has provided high-quality services for
biopharmaceutical, cell therapy, research institutes and scientific research users.
It has carried out in-depth cooperation with customers and become a reliable partner
for customers to achieve win-win results.
We take quality first as the standard, quickly respond to customer needs, help
customers solve problems, improve efficiency, and take improving core
competitiveness for customers as our service tenet. We are willing to realize our
own value while creating value for customers and society through our unremitting
efforts.
| Request Information |
| Related Products |
