Primers and probes for the detection of the new 2019 coronavirus(Sars-CoV-2) are available from ShineGene!
        The new coronavirus (2019-nCoV) was first detected in Wuhan City, Hubei Province China. Tens of thousands of infections with 2019-nCoV have been reported in China. The virus is spreading from person-to-person in parts of the world. Coronaviruses are a large family of viruses that are common in many animals, including camels, cattle, cats, and bats. However, some animal coronaviruses can infect people and spread between people, for example MERS, SARS, and now with 2019-nCoV {CDC}. 
Corona virus outbreaks in January 2020. 
Primers and probes recommended by the CDC & WHO
ShineGene can provide the primer and probe sequences recommended by the CDC and the WHO to researchers working on the coronavirus.
The sequences were publically provided by the CDC here and the WHO here. Researchers can order these primers and probes to create a panel in their lab, following the panel instructions from the CDC. 
These materials are provided for research purposes only.
ShineGene also offer the corresponding positive plasmid.
	
		
			| Name | Country | Label 5’ | Oligonucleotide Sequence (5’>3’) | Label 3’ | Position | Working Conc. [μM] | 
		
			|  |  |  | N Protein |  |  |  | 
		
			| 2019-nCoV_N1-F | USA |  | GACCCCAAAATCAGCGAAAT |  | 28287-28306 | 20 | 
		
			| 2019-nCoV_N1-R |  | TCTGGTTACTGCCAGTTGAATCTG |  | 28335-28358 | 20 | 
		
			| 2019-nCoV_N1-P | FAM | ACCCCGCATTACGTTTGGTGGACC | BHQ1 | 28309--28332 | 5 | 
		
			| 2019-nCoV_N2-F |  | TTACAAACATTGGCCGCAAA |  | 29164-29183 | 20 | 
		
			| 2019-nCoV_N2-R |  | GCGCGACATTCCGAAGAA |  | 29213-29230 | 20 | 
		
			| 2019-nCoV_N2-P | FAM | ACAATTTGCCCCCAGCGCTTCAG | BHQ1 | 29188--29210 | 5 | 
		
			| 2019-nCoV_N3-F |  | GGGAGCCTTGAATACACCAAAA |  | 28681-28702 | 20 | 
		
			| 2019-nCoV_N3-R |  | TGTAGCACGATTGCAGCATTG |  | 28732-28752 | 20 | 
		
			| 2019-nCoV_N3-P | FAM | AYCACATTGGCACCCGCAATCCTG | BHQ1 | 28706-28727 | 5 | 
		
			| 2019-nCoV-NF | China |  | GGGGAACTTCTCCTGCTAGAAT |  | 28881-28902 | 0.6 | 
		
			| 2019-nCoV-NR |  | CAGACATTTTGCTCTCAAGCTG |  | 28958-28979 | 0.8 | 
		
			| 2019-nCoV-NP | FAM | TTGCTGCTGCTTGACAGATT | TAMRA | 28934-28953 | 0.1 | 
		
			| HKU-NF | Hong Kong |  | TAATCAGACAAGGAACTGATTA |  | 29145-29166 | 0.6 | 
		
			| HKU-NR |  | CGAAGGTGTGACTTCCATG |  | 29236-29254 | 0.8 | 
		
			| HKU-NP | FAM | GCAAATTGTGCAATTTGCGG | TAMRA | 29196-29177 | 0.1 | 
		
			| NIID_2019-nCOV_N_F2 | Japanese |  | AAATTTTGGGGACCAGGAAC |  | 29142-29161 | 0.5 | 
		
			| NIID_2019-nCOV_N_R2 |  | TGGCAGCTGTGTAGGTCAAC |  | 29280-29299 | 0.7 | 
		
			| NIID_2019-nCOV_N_P2 | FAM | ATGTCGCGCATTGGCATGGA | BHQ1 | 29239-29258 | 0.2 | 
		
			| WH-NIC N-F | Thailand |  | CGTTTGGTGGACCCTCAGAT |  | 28320-28339 | 0.4 | 
		
			| WH-NIC N-R |  | CCCCACTGCGTTCTCCATT |  | 28358-28376 | 0.4 | 
		
			| WH-NIC N-P | FAM | CAACTGGCAGTAACCA | MGB | 28341-38356 | 0.1 | 
		
			|  |  |  | E gene |  |  |  | 
		
			| E_Sarbeco_F1 | Germany |  | ACAGGTACGTTAATAGTTAATAGCGT |  | 26269-26294 | 0.4 | 
		
			| E_Sarbeco_R2 |  | ATATTGCAGCAGTACGCACACA |  | 26360-26381 | 0.4 | 
		
			| E_Sarbeco_P1 | FAM | ACACTAGCCATCCTTACTGCGCTTCG | BHQ1 | 26332-26357 | 0.2 | 
		
			| CoV-EFP | China |  | ACTTCTTTTTCTTGCTTTCGTGGT |  | 26295-26318 | 20 | 
		
			| CoV-ERP |  | GCAGCAGTACGCACACAATC |  | 26357-26376 | 20 | 
		
			| CoV-EP | FAM | CTAGTTACACTAGCCATCCTTACTGC | BHQ1 | 26326-26351 | 5 | 
		
			|  |  |  | ORF1ab |  |  |  | 
		
			| 2019-nCoV-OFP | China |  | CCCTGTGGGTTTTACACTTAA |  | 13342-13362 | 0.6 | 
		
			| 2019-nCoV-ORP |  | ACGATTGTGCATCAGCTGA |  | 13442-13460 | 0.8 | 
		
			| 2019-nCoV-OP | FAM | CCGTCTGCGGTATGTGGAAAGGTTATGG | BHQ1 | 13377--13404 | 0.1 | 
		
			| HKU-ORF1b-nsp14F | Hong Kong |  | TGGGGYTTTACRGGTAACCT |  | 18778-18797 | 0.6 | 
		
			| HKU- ORF1b-nsp14R |  | AACRCGCTTAACAAAGCACTC |  | 18889-18909 | 0.8 | 
		
			| HKU-ORF1b-nsp141P | FAM | TAGTTGTGATGCWATCATGACTAG | TAMRA | 18849--18872 | 0.1 | 
		
			| RdRP_SARSr-F2 | Germany |  | GTGARATGGTCATGTGTGGCGG |  | 15431-15452 | 0.6 | 
		
			| RdRP_SARSr-R1 |  | CARATGTTAAASACACTATTAGCATA |  | 15435-15460 | 0.8 | 
		
			| RdRP_SARSr-P2 | FAM | CAGGTGGAACCTCATCAGGAGATGC | BHQ1 | 15470-15494 | 0.1 | 
		
			| Name |  | Label 5’ | Oligonucleotide Sequence (5’>3’) | Label 3’ |  | Working Conc. [μM] | 
		
			| Internal standard |  |  | RNAse Protein/NM_006413.5 |  |  |  | 
		
			| RP-F | Recognized |  | AGATTTGGACCTGCGAGCG |  | 28-46 | 20 | 
		
			| RP-R |  | GAGCGGCTGTCTCCACAAGT |  | 73-92 | 20 | 
		
			| RP-P RNAse P | FAM | TTCTGACCTGAAGGCTCTGCGCG | BHQ1 | 49-71 | 5 | 
	
Note:
In order to prevent any cross-contamination of primers and probes with control plasmids, our standard procedure is to spatially separated our production of oligos and genes/plasmisds by separate rooms and  air systems!
Publications
1.(2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
2.(2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
3.(2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
4.(2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
Related Link
8-Strip Tip Comb 
Kingfisher 96 Deep Well Tip Combs 
Spin Column
Pipette Tips With Filter 
Proteinase K
SARS-CoV-2 Primer and Probe
SARS-CoV-2 RT-qPCR Kit
Oligo Synthesis
Taqman probe
Peptide Synthesis
Chromas
Make Antibody
Lab Consumables
Gene Synthesis
dNTP
 
------------------------------------------------------------------------------------
Floor 2,Gate 6,289#,Minqiang Road,Songjiang District,Shanghai 201612,China
Tel:0086-21-54460832    Fax:0086-21-54460831-13    E-mail:master@shinegene.org.cn
 
bio-equip.cn