Login    Join free Add to favorites    中文
Home >Products> Synthesizers | Sequencers | Cell Analysis >DNA / Organic / Polypeptide Synthesizers> Nucleic acid synthesizer(AUTOOLIGO25~150)
Synthesizers | Sequencers | Cell Analysis:  DNA / Organic / Polypeptide Synthesizers   Genomics / Sequencers   Cell Analysis   Proteomics  
Nucleic acid synthesizer(AUTOOLIGO25~150)
Nucleic acid synthesizer(AUTOOLIGO25~150)
Origin of place China
Model 25ml/min,100ml/min,150ml/min
Supplier SUZHOU COSTONE INSTRUMENT CO., LTD.
Price
Hits 966
Updated 3/10/2026
  • Product Detail
  • Company Profile
UTOOLIGO is a flexible and intuitive full-automatic oligonucleotide synthesizer, which can be used for 1 μ The rapid synthesis of mol-50mmol nucleic acid sample is suitable for clinical research, medical development and the synthesis of molecular diagnostic probes.
AUTOOLIGO comes in four models:
● AUTOOLIGO, synthesis capacity 10~100 μ mol
● AUTOOLIGO100, synthetic capacity 50 μ mol~9mmol
● AUTOOLIGO150, synthesis capacity 150 μ mol~12 mmol
● AUTOOLIGO600, synthesis capacity 1mmol-50mmol
Unique AutoOligo adopts a high-precision metering pump drive system, which is compatible with reagents for nucleic acid synthesis. The adoption of flow solid phase column synthesis technology can significantly reduce reagent consumption, ensure the accurate control of reaction speed and contact time, and at the same time, the synthesis efficiency is higher, facilitating linear amplification, so as to obtain cost-effective and high-quality synthesis results.
AUTOOLIGO can use up to 14 kinds of monomers at the same time, and continuously and automatically perform the synthesis process on 1 or 3 or 8 columns.
The CD System workstation has a powerful data management system to provide you with a complete and reliable nucleic acid synthesis method development platform.
● High precision metering pump, flow path resistant to organic reagents;
● Multiple column positions are optional;
● High degree of automation and low reagent consumption;
● Monomer solution recycling;
● Sequential synthesis;
● High production capacity: one synthetic cycle can be completed within 20 minutes at the earliest;
● Online monitoring of ultraviolet, conductivity signal and pressure;
● The software interface is friendly and the method can be edited flexibly;
● Comply with relevant regulations and requirements of FDA and USP;
Equipment parameters (AUTOOLIGO25~150)
No. project Parameter Description
1 Current Speed Oligo 25: 2 x 25ml/min
2 Synthesis scale Oligo 100: 2 x 100ml/min
3 Synthetic efficiency Oligo 150: 2 x 150ml/min
4 Cycle time one μ mol ~ 12mmol
5 System pump >99%forDNA >98%forRNA
6 Number of composite columns 4.5 to 25 min (standard DNA)
7 Number of monomer entrances Two pump system
8 UV detector 1. 3. Maximum 8
9 Conductivity detector 8. 14
10 System protection UV detector Wavelength range of UV detector: 200-600nm, 4 channels
11 Intake pressure Argon or nitrogen
12 valve 0.3~0.35bar
13 Control system 7 low dead volume valves
14 Chemical solvent compatibility CDSystem
  Dimensions (WxHxD) Compatible with common reagents for DNA and RNA synthesis, acetonitrile, coupling reagents, capping agents, oxidizing agents, capping agents, thio reagents, etc. (incompatible with tetrahydrofuran)
15 weight 400 x 550 x 480mm
16 Power Supply 60kg
17 project 220V

Synthesis case 1: DNA 17mer synthesis
objective
Synthesis of an oligonucleotide DNA strand, sequence: CTACGCCACGAGCTACTACCA, synthesis amount 0.24 mmol
● Environmental conditions
Room temperature 25 ℃ Humidity 60%
● Laboratory supplies
1. Nucleic acid synthesizer: AUTOOLIGO 100
2.6.3ml synthetic column
3. Carrier: HYS 350
4. Deprotection reagent: coupling reagent, oxidation reagent, blocking reagent, anhydrous acetonitrile, ammonia
5. Monomer: A, C, G, T
6.0.3bar ammonia
7. Mass spectrometer: Waters - THERMO
8 . HPLC: WATERS
Case 3: RNA 21mer synthesis:
Purpose:
Synthesis of one RNA chain, 21mer, synthesis amount 245 μ mol
Instrument: AUTOOLIGO results and analysis:
The purity of the crude product was 84.84% and 94.37% after one-step purification. The molecular weight detected by mass spectrometry is 7097.7, which is consistent with the theoretical value (7096.8).




 
bio-equip.cn
Request Infomation

* Name:
Title:
* Tel:
Fax:
* E-mail:
Postcode:
Institution/Company:
Address:
* Country:
Request infomation:
yes no
Request Quotation:
yes no
* Message:
Validated Code:
refresh
I agree to share my inquiry to the other matching suppliers.



Copyright(C) 2006-2026 Bio-Equip    E-mail:web@bio-equip.cn   沪ICP备06040519号